circad | circRNAs associated with diseases

hsa_circ_0003570
Gene	FAM53B	Organism	Human
Genome Locus	chr10:126370175-126384781:-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	28493512
Experimental Method
Sample Type	Tissues and HepG2,SMMC-7721, L02 Cell lines	Comparison	107 pairs of HCC tissues and adjacent non-tumorous �tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAAGATGGCACAGCAGCACACGC Reverse ATGCTGGTGCTCGGTTGGTC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Fu, L, Wu, S, Yao, T, Chen, Q, Xie, Y, Ying, S, Chen, Z, Xiao, B, Hu, Y (2018). Decreased expression of hsa_circ_0003570 in hepatocellular carcinoma and its clinical significance. J. Clin. Lab. Anal., 32, 2:no page given.